- Poster presentation
- Open Access
- Published:
Development of an ELISA using the recombinant protein CP1957 of Corynebacterium pseudotuberculosis for diagnosis of caseous lymphadenitis in sheep
BMC Proceedings volume 8, Article number: P163 (2014)
Background
Caseous lymphadenitis (CLA) is a disease caused by the bacteria Corynebacterium pseudotuberculosis which affects small ruminants such as sheeps and goats, leading to severe economic losses. The development of more sensitive and specific diagnoses showing effectiveness on asymptomatic animals is essential for disease's control. This study purposes the use of the recombinant protein CP1957 of C. pseudotuberculosis in indirect ELISA using sheep sera.
Methods
The amplification of the cp1002_1957 gene was performed using the primers F5' CGCGGATCCGGGCCTCGCGACTGG 3' and R5' CCGGAATTCTTACCAGGCGTTCATAACGT 3'. The cp1002_1957 gene was cloned in the BamHI e EcoRI sites of the pAE vector. The recombinant clones (pAE/1957) were characterized enzymatically and by DNA sequencing. E. coli BL21 Star cells were transformed with the pAE/1957 vector for the expression of rCP1957 protein, the induction was performed by the addition of IPTG 1mM to the culture media. The purification was realized by affinity chromatography on a Sepharose column loaded with nickel. The purity was determined using a 12% SDS-PAGE, and the concentration determined by a BCA kit. For indirect ELISA, the purified rCP1957 was utilized as antigen in a concentration of 1µg/mL. The sheep sera and the anti-sheep conjugated with peroxidase were used in 1:100 and 1:5000 dilutions, respectively. A total of 49 sheep sera were analyzed, where 14 were from asymptomatic animals and 35 were from negative animals. The sensitivity and specificity of ELISA-r1957 were analyzed on receiver operating characteristic (ROC).
Results and conclusion
The statistical analysis of the ELISA-rCP1957 results presented sensitivity and specificity values of 92.9% e 85.7%, respectively, when the absorbance cutoff value of 0.063 was used. Thus, we can conclude that the developed ELISA, using the recombinant protein CP1957 can be used for the CLA diagnoses with good levels of sensitivity and specificity.
References
Dorella FA, Pacheco LG, Meyer R, Portela RW, Miyoshi A, Azevedo V: A description of genes of Corynebacteriumpseudotuberculosisuseful in diagnostics and vaccine applications. Genet Mol Res. 2008, 7 (1): 252-260. 10.4238/vol7-1gmr438.
Dercksen DP, Brinkhof JM, Dekker-Nooren T, Maanen K, Bode CF, Baird G, Kamp EM: A comparison of four serological tests for the diagnosis of caseous lymphadenitis in sheep and goats. Vet Microbiol. 2000, 75 (2): 167-175. 10.1016/S0378-1135(00)00217-0.
Guimarães Ade S, Dorneles EM, Andrade GI, Lage AP, Miyoshi A, Azevedo V, Gouveia AM, Heinemann MB: Molecular characterization of Corynebacterium pseudotuberculosis isolates using ERIC-PCR. Vet Microbiol. 2011, 153 (3-4): 299-306. 10.1016/j.vetmic.2011.06.002.
Huerta B, Gómez-Gascón L, Vela AI, Fernandez-Garayzabal JF, Casamayor C, Maldonado A: Comparison of two biochemical methods for identifying Corynebacteriumpseudotuberculosis isolated from sheep and goats. Vet J. 2013, 196 (3): 552-554. 10.1016/j.tvjl.2012.12.008.
Santos AR, Carneiro A, Gala-García A, Pinto A, Barh D, Barbosa E, Aburjaile F, Dorella F, Rocha F, Guimaraes L, Zurita-Turk M, Ramos R, Almeida S, Soares S, Pereira U, Abreu VC, Silva A, Miyoshi A, Azevedo V: The Corynebacterium pseudotuberculosis in silico predicted pan-exoproteome. BMC Genomics. 2012, 13 (Suppl 5): S6-10.1186/1471-2164-13-S5-S6.
Acknowledgements
Foundation for Research Support of the State of Rio Grande do Sul (FAPERGS), through project No. 11/1894-0, and CNPq.
Author information
Authors and Affiliations
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Rosa Reis, C.G., Ramos Angelo, H., Silva Rezende, A.d.F. et al. Development of an ELISA using the recombinant protein CP1957 of Corynebacterium pseudotuberculosis for diagnosis of caseous lymphadenitis in sheep. BMC Proc 8 (Suppl 4), P163 (2014). https://doi.org/10.1186/1753-6561-8-S4-P163
Published:
DOI: https://doi.org/10.1186/1753-6561-8-S4-P163
Keywords
- Receiver Operating Characteristic
- Affinity Chromatography
- Specific Diagnose
- Small Ruminant
- Indirect ELISA